hfv top banner
HFV Ebola sequence database
 

SimpleGC Explanation

SimpleGC is for a small sequence set whose analysis can be completed within a couple of minutes. Input must be aligned if number of seqs > 1.

Examples of how to use

> curl --form "seq_input=ATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGGCCTACTGTAAGGGAAAGAATGAGACGAGCT" https://www.hiv.lanl.gov/cgi-bin/GENE_CUTTER/simpleGC  
> curl --form "seq_upload=@sample.fasta" https://www.hiv.lanl.gov/cgi-bin/GENE_CUTTER/simpleGC
> curl --form "seq_upload=@sample.fasta" --form "region=env" --form "translate=No"  https://www.hiv.lanl.gov/cgi-bin/GENE_CUTTER/simpleGC


Parameters
Parameter Description and Possible values Default Required
seq_input A raw na sequence either seq_input or seq_upload required
seq_upload File path of na sequence set
organism HIV-1
HIV-2
SIV
HIV-1
region Region(s) to align and extract

All: All genes and complete sequence
Genomer: Complete sequence
5LTR: 5' LTR
Gag: Gag
Pol: Pol CDS
Gag_Pol: Gag-Pol
Vif: Vif CDS
Vpx: Vpx CDS
Vpu: Vpu CDS
Vpr: Vpr CDS
Tat: Tat exons
Tat1: Tat exon 1
Tat2: Tat exon 2
Tat_CDS: Tat CDS (includes intron)
Rev: Rev exons
Rev1: Rev exon 1
Rev2: Rev exon 2
Rev_CDS: Rev CDS (includes intron)
Env: Env CDS
NEF: Nef CDS
3LTR: 3' LTR
Matrix: Matrix (p17/p15)
Capsid: Capsid (p24/p27)
p2: p2
Nucleocapsid: Nucleocapsid (p7/p8)
p1: p1
p6: p6
Protease: Protease
RT: RT (p51)
RNase: RNase (p15)
Integrase: Integrase (p31)
gp120: gp120
gp41: gp41
V1: V1
V2: V2
V3: V3
V4: V4
V5: V5
RRE: RRE
ALL
insert_ref Whether insert a reference sequence, Hxb2(K03455) for HIV-1 or Mac239(M33262) for HIV-2/SIV, into results or not

Yes
No
No
remove_ref Whether remove a reference sequence, Hxb2(K03455) for HIV-1 or Mac239(M33262) for HIV-2/SIV, from results or not

Yes
No
No
codon_align Whether codon-align the region. 'Yes' will insert gaps into your alignment so that the region alignment stays in the correct reading frame, even if your sequences contain frameshifts.

Yes
No
Yes
compensate_fs Number of allowed codons to compensate two frameshifts which are close to each other within this distance

integers
15
translate How to translate to amino acids

Yes: Codons containing an IUPAC character shown as "X" icon
Yes2: Codons containing an IUPAC character in a silent position translated; others shown as "X" icon
Yes3: Codons containing an IUPAC character translated
NO: Do not translate
Yes3
return_format gc: Gene Cutter result format
table: Table
fasta: Fasta
mas: Mase
rsf: RSF
gdeflat: GDE flat
gde: GDE
pir: PIR
gcg: GCG
clust: Clustal
phi: Phylip interleaved
phs: Phylip sequential
msf:MSF
megs: MEGA sequential
megi: MEGA interleaved
nexusi: NEXUS interleaved
nexuss: NEXUS sequential
stock: Stockholm
slx: SLX
pret: Pretty
oal: Output aligned
csv: CSV
gc



Questions or comments? Contact us at hfv-info@lanl.gov